Review



pcr product library  (tiangen biotech co)


Bioz Verified Symbol tiangen biotech co is a verified supplier
Bioz Manufacturer Symbol tiangen biotech co manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    tiangen biotech co pcr product library
    Pcr Product Library, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 94/100, based on 185 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pmc11544962-109-3-9?v=tiangen+biotech+co
    Average 94 stars, based on 185 article reviews
    pcr product library - by Bioz Stars, 2026-08
    94/100 stars

    Images



    Similar Products

    99
    New England Biolabs sgrna library pcr product
    a, Schematic of construction of pBx-Gm and pBx-Amp, two plasmids for high-efficiency, high-fidelity <t>sgRNA</t> cloning. b , Schematic of the positions of PAMs for which sgRNAs were included in the library in the NT (green triangles) or T (red triangles) strand of coding sequences, or on both strands in intergenic regions (orange triangles). PAMs on the T strand for which no sgRNAs were included are shown by dotted triangles. CDS, coding sequence. c , Schematic of the sgRNA oligo pool design and the <t>PCR-based</t> second-stranding and amplification method using oligos 14919 and 14920 priming in universal flanking M13 and M13R binding regions. RC, reverse complement. d , Distribution of number of sgRNAs per gene or intergenic region. e , Correlation of number of sgRNAs per gene and gene length. f , Distribution of sequencing reads for all designed sgRNAs in the final pBx-Gm-based library. g , Distribution of gene length of genes that are covered by at least 3 sgRNAs, each with at least 10 sequencing reads (orange), and those that do not meet this criterion (blue) shown for the pBx-Gm-based library. Note that characteristics of the pBx-Amp-based library are very similar to the ones shown here for the pBx-Gm-based library.
    Sgrna Library Pcr Product, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/bio_rxiv__2025__08__12__669819-218-29-41?v=New+England+Biolabs
    Average 99 stars, based on 1 article reviews
    sgrna library pcr product - by Bioz Stars, 2026-08
    99/100 stars
      Buy from Supplier

    86
    Novogene pcr product library
    a, Schematic of construction of pBx-Gm and pBx-Amp, two plasmids for high-efficiency, high-fidelity <t>sgRNA</t> cloning. b , Schematic of the positions of PAMs for which sgRNAs were included in the library in the NT (green triangles) or T (red triangles) strand of coding sequences, or on both strands in intergenic regions (orange triangles). PAMs on the T strand for which no sgRNAs were included are shown by dotted triangles. CDS, coding sequence. c , Schematic of the sgRNA oligo pool design and the <t>PCR-based</t> second-stranding and amplification method using oligos 14919 and 14920 priming in universal flanking M13 and M13R binding regions. RC, reverse complement. d , Distribution of number of sgRNAs per gene or intergenic region. e , Correlation of number of sgRNAs per gene and gene length. f , Distribution of sequencing reads for all designed sgRNAs in the final pBx-Gm-based library. g , Distribution of gene length of genes that are covered by at least 3 sgRNAs, each with at least 10 sequencing reads (orange), and those that do not meet this criterion (blue) shown for the pBx-Gm-based library. Note that characteristics of the pBx-Amp-based library are very similar to the ones shown here for the pBx-Gm-based library.
    Pcr Product Library, supplied by Novogene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pm42109165-66-1-17?v=Novogene
    Average 86 stars, based on 1 article reviews
    pcr product library - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    90
    Illumina Inc page purified primer for ngs of pcr products from crispr library screening

    Page Purified Primer For Ngs Of Pcr Products From Crispr Library Screening, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pmc11697544-92-0-0?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    page purified primer for ngs of pcr products from crispr library screening - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    97
    Illumina Inc amplicon pcr product dna

    Amplicon Pcr Product Dna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pmc11619574-106-8-15?v=Illumina+Inc
    Average 97 stars, based on 1 article reviews
    amplicon pcr product dna - by Bioz Stars, 2026-08
    97/100 stars
      Buy from Supplier

    90
    Illumina Inc 5′ pam library pcr product

    5′ Pam Library Pcr Product, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pm39562558-293-5-23?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    5′ pam library pcr product - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    Illumina Inc 5’ pam library pcr product

    5’ Pam Library Pcr Product, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pmc11576732__41467_2024_54365_MOESM17_ESM-140-6-23?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    5’ pam library pcr product - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    94
    tiangen biotech co pcr product library

    Pcr Product Library, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pmc11544962-109-3-9?v=tiangen+biotech+co
    Average 94 stars, based on 1 article reviews
    pcr product library - by Bioz Stars, 2026-08
    94/100 stars
      Buy from Supplier

    90
    Illumina Inc 16 s v3–v4 pcr product library

    16 S V3–V4 Pcr Product Library, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pm39390011-240-7-18?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    16 s v3–v4 pcr product library - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    Illumina Inc pcr product libraries sequenced on the illumina novaseq 6000 platform
    (A) Analysis of the stem region sequence diversity of PSTVd quasispecies from mutant pool, IR, LM, and Sys samples. A total of 30 libraries were sequenced using the Illumina <t>NovaSeq</t> <t>6000</t> platform, and normalized Shannon entropy of the pool and the three selected loop sequences was calculated as described in the text. Values range from 0 to 1, with higher values indicating greater sequence diversity. (B) Read number of the top 20 most frequently detected variants from deep-sequenced libraries. The number of reads for the top 20 most frequently detected variants from the deep-sequenced libraries were normalized to a per-thousand basis and plotted on a log 2 scale. (C) The number of unique sequences in deep sequencing libraries. The number of unique sequences of all deep sequencing libraries were normalized to a per-thousand basis and presented. Data are expressed as mean ± standard deviations (normalized Shannon entropy and number of unique sequences per thousand reads) or average values (reads number of the top 20 most frequently detected variants per thousand reads) for IR, LM, and Sys samples and a single value for the inoculum pools. Student’s t-test was applied for comparisons: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns , not statistically significant. (D) Sequences of both strands of stems S3, S15, and S26 were isolated from the deep sequencing dataset, and the base pairs formed by two strands of the same stem were analyzed. By comparing them to the WT sequence as a reference, the mutated base pairs at each position were analyzed. The weighted number of group 1 and group 2 mutated base pairs was calculated and compared between different samples (see text for details). Data are expressed as the mean ± standard deviations for IR, LM, and Sys samples, and as a single value for the inoculum pools. Student’s t-test was applied for data comparisons: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns , not statistically significant.
    Pcr Product Libraries Sequenced On The Illumina Novaseq 6000 Platform, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcr+product+library/pmc11020406-325-9-8?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    pcr product libraries sequenced on the illumina novaseq 6000 platform - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    Image Search Results


    a, Schematic of construction of pBx-Gm and pBx-Amp, two plasmids for high-efficiency, high-fidelity sgRNA cloning. b , Schematic of the positions of PAMs for which sgRNAs were included in the library in the NT (green triangles) or T (red triangles) strand of coding sequences, or on both strands in intergenic regions (orange triangles). PAMs on the T strand for which no sgRNAs were included are shown by dotted triangles. CDS, coding sequence. c , Schematic of the sgRNA oligo pool design and the PCR-based second-stranding and amplification method using oligos 14919 and 14920 priming in universal flanking M13 and M13R binding regions. RC, reverse complement. d , Distribution of number of sgRNAs per gene or intergenic region. e , Correlation of number of sgRNAs per gene and gene length. f , Distribution of sequencing reads for all designed sgRNAs in the final pBx-Gm-based library. g , Distribution of gene length of genes that are covered by at least 3 sgRNAs, each with at least 10 sequencing reads (orange), and those that do not meet this criterion (blue) shown for the pBx-Gm-based library. Note that characteristics of the pBx-Amp-based library are very similar to the ones shown here for the pBx-Gm-based library.

    Journal: bioRxiv

    Article Title: Genome-wide high-density CRISPR interference screens reveal condition-specific metabolic vulnerabilities in Pseudomonas aeruginosa PAO1

    doi: 10.1101/2025.08.12.669819

    Figure Lengend Snippet: a, Schematic of construction of pBx-Gm and pBx-Amp, two plasmids for high-efficiency, high-fidelity sgRNA cloning. b , Schematic of the positions of PAMs for which sgRNAs were included in the library in the NT (green triangles) or T (red triangles) strand of coding sequences, or on both strands in intergenic regions (orange triangles). PAMs on the T strand for which no sgRNAs were included are shown by dotted triangles. CDS, coding sequence. c , Schematic of the sgRNA oligo pool design and the PCR-based second-stranding and amplification method using oligos 14919 and 14920 priming in universal flanking M13 and M13R binding regions. RC, reverse complement. d , Distribution of number of sgRNAs per gene or intergenic region. e , Correlation of number of sgRNAs per gene and gene length. f , Distribution of sequencing reads for all designed sgRNAs in the final pBx-Gm-based library. g , Distribution of gene length of genes that are covered by at least 3 sgRNAs, each with at least 10 sequencing reads (orange), and those that do not meet this criterion (blue) shown for the pBx-Gm-based library. Note that characteristics of the pBx-Amp-based library are very similar to the ones shown here for the pBx-Gm-based library.

    Article Snippet: The sgRNA library was then cloned in pBx-Gm or pBx-Amp using Golden Gate assembly in a reaction containing 10 μl pBx_Gm (67 ng/μl) or pBx_AmpR (72 ng/μl), 10 μl sgRNA library PCR product (16 ng/μl), 4000 units of T4 DNA ligase (NEB #M0202S) and 120 units of BsaI-HFv2 (NEB #R3733S) in ligase buffer (NEB #B0202) in a total volume of 200 μl.

    Techniques: Cloning, Sequencing, Amplification, Binding Assay

    a , Heatmap of log2 fold-changes (LFC) of all genes that showed significant enrichment or depletion (P-val<0.05, |LFC|>1) in at least one condition plotted using the seaborne.clustermap function and average clustering method. b , Venn diagrams depicting pairwise comparisons of Median and Second-best quantification methods after 24h or 48h of growth (panels i-v) and indicated comparisons to the gene essentiality data by Lee et al ., 2015 (panel vi). Note that for panels i-v both enriched and depleted genes were included, whereas for comparisons in panel vi only depleted genes, i.e. genes whose CRISPRi-mediated repression causes fitness defects, were used. The number of genes in each sector of the Venn diagrams is indicated. c , Top: Functionally enriched categories in the current (red) or the Lee et al . dataset (blue) on LB medium as determined using the String database ( Szklarczyk et al , 2023 ). Bottom: LFCs for all sgRNAs of select genes under different growth conditions. Each dot represents the LFC of a single sgRNA calculated from four independent biological replicates, and the median of all sgRNA LFCs for one gene is indicated by a brown line. The grey dashed line marks the -1 LFC threshold. For genes, PA numbers (locus tags) as well as their annotations according to a reference genome annotation file ( Stover et al , 2000 ) are given at the bottom. d , Venn diagrams for genes for which sgRNAs were depleted in at least one of the three tested growth conditions upon induction versus the LB uninduced control are shown along with functionally enriched categories according to the String database. Single select genes are listed in parentheses if the belonged to an enriched category or without if they were not recognized as such by String. e , Similar to d, but for genes whose downregulation improved fitness, i.e. their sgRNAs were enriched. The dotted boxes for glucose and succinate conditions indicate that no functionally enriched categories were identified; instead, we highlight individual genes that deemed interesting to us.

    Journal: bioRxiv

    Article Title: Genome-wide high-density CRISPR interference screens reveal condition-specific metabolic vulnerabilities in Pseudomonas aeruginosa PAO1

    doi: 10.1101/2025.08.12.669819

    Figure Lengend Snippet: a , Heatmap of log2 fold-changes (LFC) of all genes that showed significant enrichment or depletion (P-val<0.05, |LFC|>1) in at least one condition plotted using the seaborne.clustermap function and average clustering method. b , Venn diagrams depicting pairwise comparisons of Median and Second-best quantification methods after 24h or 48h of growth (panels i-v) and indicated comparisons to the gene essentiality data by Lee et al ., 2015 (panel vi). Note that for panels i-v both enriched and depleted genes were included, whereas for comparisons in panel vi only depleted genes, i.e. genes whose CRISPRi-mediated repression causes fitness defects, were used. The number of genes in each sector of the Venn diagrams is indicated. c , Top: Functionally enriched categories in the current (red) or the Lee et al . dataset (blue) on LB medium as determined using the String database ( Szklarczyk et al , 2023 ). Bottom: LFCs for all sgRNAs of select genes under different growth conditions. Each dot represents the LFC of a single sgRNA calculated from four independent biological replicates, and the median of all sgRNA LFCs for one gene is indicated by a brown line. The grey dashed line marks the -1 LFC threshold. For genes, PA numbers (locus tags) as well as their annotations according to a reference genome annotation file ( Stover et al , 2000 ) are given at the bottom. d , Venn diagrams for genes for which sgRNAs were depleted in at least one of the three tested growth conditions upon induction versus the LB uninduced control are shown along with functionally enriched categories according to the String database. Single select genes are listed in parentheses if the belonged to an enriched category or without if they were not recognized as such by String. e , Similar to d, but for genes whose downregulation improved fitness, i.e. their sgRNAs were enriched. The dotted boxes for glucose and succinate conditions indicate that no functionally enriched categories were identified; instead, we highlight individual genes that deemed interesting to us.

    Article Snippet: The sgRNA library was then cloned in pBx-Gm or pBx-Amp using Golden Gate assembly in a reaction containing 10 μl pBx_Gm (67 ng/μl) or pBx_AmpR (72 ng/μl), 10 μl sgRNA library PCR product (16 ng/μl), 4000 units of T4 DNA ligase (NEB #M0202S) and 120 units of BsaI-HFv2 (NEB #R3733S) in ligase buffer (NEB #B0202) in a total volume of 200 μl.

    Techniques: Control

    a , Schematic of the central carbon metabolism of P. aeruginosa PAO1. Metabolites are shown in black, enzymes and the reactions they potentially catalyze (arrows) are color-coded according to their CRISPRi scores: blue, no significant change under any conditions; dark orange, essential under all growth conditions; light orange, essential under minimal medium conditions in general; green, essential in glucose conditions only; magenta, essential in succinate conditions only. Parts of the EDEMP cycle that are derived from the EMP, ED or PP pathways are highlighted by different colors, as is the TCA cycle (light blue). Abbreviations for metabolites are defined in the main text or are as follows: DHAP, dihydroxyacetone phosphate; KDPG, 2-keto-3-deoxy-6-phosphogluconate; E4P, erythrose-4-phosphate; S7P, sedoheptulose-7-phosphate; X5P, xylulose-5-phosphate; CIT, citrate; SUC, succinate; FUM, fumarate; MAL, malate. b , LFCs for all sgRNAs of central carbon metabolism genes/proteins mapped in panel a are shown for the three different growth conditions: LB-Miller, MOPS/glucose and MOPS/succinate. Each dot represents the log2 fold-change (LFC) of a single sgRNA calculated from four independent biological replicates, and the median of all sgRNA LFCs for one gene is indicated by a brown line. The grey dashed line marks the -1 LFC threshold. For genes, PA numbers (locus tags) as well as their annotations according to a reference genome annotation file ( Stover et al , 2000 ) are given at the bottom. Asterisks indicate genes that were generally essential as defined by our cutoff, but showed clear quantitative differences between glucose- and succinate-grown cells. GapN (PA2323) and GapB (PA3001) together with Pgk (PA0552), key enzymes in lower glycolysis which are differentially required during growth on glucose and succinate and discussed in the main text, are highlighted in bold and with green and magenta backgrounds, respectively.

    Journal: bioRxiv

    Article Title: Genome-wide high-density CRISPR interference screens reveal condition-specific metabolic vulnerabilities in Pseudomonas aeruginosa PAO1

    doi: 10.1101/2025.08.12.669819

    Figure Lengend Snippet: a , Schematic of the central carbon metabolism of P. aeruginosa PAO1. Metabolites are shown in black, enzymes and the reactions they potentially catalyze (arrows) are color-coded according to their CRISPRi scores: blue, no significant change under any conditions; dark orange, essential under all growth conditions; light orange, essential under minimal medium conditions in general; green, essential in glucose conditions only; magenta, essential in succinate conditions only. Parts of the EDEMP cycle that are derived from the EMP, ED or PP pathways are highlighted by different colors, as is the TCA cycle (light blue). Abbreviations for metabolites are defined in the main text or are as follows: DHAP, dihydroxyacetone phosphate; KDPG, 2-keto-3-deoxy-6-phosphogluconate; E4P, erythrose-4-phosphate; S7P, sedoheptulose-7-phosphate; X5P, xylulose-5-phosphate; CIT, citrate; SUC, succinate; FUM, fumarate; MAL, malate. b , LFCs for all sgRNAs of central carbon metabolism genes/proteins mapped in panel a are shown for the three different growth conditions: LB-Miller, MOPS/glucose and MOPS/succinate. Each dot represents the log2 fold-change (LFC) of a single sgRNA calculated from four independent biological replicates, and the median of all sgRNA LFCs for one gene is indicated by a brown line. The grey dashed line marks the -1 LFC threshold. For genes, PA numbers (locus tags) as well as their annotations according to a reference genome annotation file ( Stover et al , 2000 ) are given at the bottom. Asterisks indicate genes that were generally essential as defined by our cutoff, but showed clear quantitative differences between glucose- and succinate-grown cells. GapN (PA2323) and GapB (PA3001) together with Pgk (PA0552), key enzymes in lower glycolysis which are differentially required during growth on glucose and succinate and discussed in the main text, are highlighted in bold and with green and magenta backgrounds, respectively.

    Article Snippet: The sgRNA library was then cloned in pBx-Gm or pBx-Amp using Golden Gate assembly in a reaction containing 10 μl pBx_Gm (67 ng/μl) or pBx_AmpR (72 ng/μl), 10 μl sgRNA library PCR product (16 ng/μl), 4000 units of T4 DNA ligase (NEB #M0202S) and 120 units of BsaI-HFv2 (NEB #R3733S) in ligase buffer (NEB #B0202) in a total volume of 200 μl.

    Techniques: Derivative Assay

    Journal: STAR Protocols

    Article Title: Protocol for iterative enrichment of integrated sgRNAs via derivative CRISPR-Cas9 libraries from genomic DNA of sorted fixed cells

    doi: 10.1016/j.xpro.2024.103493

    Figure Lengend Snippet:

    Article Snippet: Illumina-sgRNA_seq: PAGE purified primer for NGS of PCR products from CRISPR library screening. ACACTCTCTTGTGGAAAGGACGAAACACCG , This paper , Lab ID: Pr1435.

    Techniques: Polymer, Recombinant, Purification, Modification, Saline, Cell Culture, Gel Extraction, Plasmid Preparation, Membrane, Transfection, Software, CRISPR, Library Screening

    (A) Analysis of the stem region sequence diversity of PSTVd quasispecies from mutant pool, IR, LM, and Sys samples. A total of 30 libraries were sequenced using the Illumina NovaSeq 6000 platform, and normalized Shannon entropy of the pool and the three selected loop sequences was calculated as described in the text. Values range from 0 to 1, with higher values indicating greater sequence diversity. (B) Read number of the top 20 most frequently detected variants from deep-sequenced libraries. The number of reads for the top 20 most frequently detected variants from the deep-sequenced libraries were normalized to a per-thousand basis and plotted on a log 2 scale. (C) The number of unique sequences in deep sequencing libraries. The number of unique sequences of all deep sequencing libraries were normalized to a per-thousand basis and presented. Data are expressed as mean ± standard deviations (normalized Shannon entropy and number of unique sequences per thousand reads) or average values (reads number of the top 20 most frequently detected variants per thousand reads) for IR, LM, and Sys samples and a single value for the inoculum pools. Student’s t-test was applied for comparisons: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns , not statistically significant. (D) Sequences of both strands of stems S3, S15, and S26 were isolated from the deep sequencing dataset, and the base pairs formed by two strands of the same stem were analyzed. By comparing them to the WT sequence as a reference, the mutated base pairs at each position were analyzed. The weighted number of group 1 and group 2 mutated base pairs was calculated and compared between different samples (see text for details). Data are expressed as the mean ± standard deviations for IR, LM, and Sys samples, and as a single value for the inoculum pools. Student’s t-test was applied for data comparisons: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns , not statistically significant.

    Journal: PLOS Pathogens

    Article Title: RNA three-dimensional structure drives the sequence organization of potato spindle tuber viroid quasispecies

    doi: 10.1371/journal.ppat.1012142

    Figure Lengend Snippet: (A) Analysis of the stem region sequence diversity of PSTVd quasispecies from mutant pool, IR, LM, and Sys samples. A total of 30 libraries were sequenced using the Illumina NovaSeq 6000 platform, and normalized Shannon entropy of the pool and the three selected loop sequences was calculated as described in the text. Values range from 0 to 1, with higher values indicating greater sequence diversity. (B) Read number of the top 20 most frequently detected variants from deep-sequenced libraries. The number of reads for the top 20 most frequently detected variants from the deep-sequenced libraries were normalized to a per-thousand basis and plotted on a log 2 scale. (C) The number of unique sequences in deep sequencing libraries. The number of unique sequences of all deep sequencing libraries were normalized to a per-thousand basis and presented. Data are expressed as mean ± standard deviations (normalized Shannon entropy and number of unique sequences per thousand reads) or average values (reads number of the top 20 most frequently detected variants per thousand reads) for IR, LM, and Sys samples and a single value for the inoculum pools. Student’s t-test was applied for comparisons: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns , not statistically significant. (D) Sequences of both strands of stems S3, S15, and S26 were isolated from the deep sequencing dataset, and the base pairs formed by two strands of the same stem were analyzed. By comparing them to the WT sequence as a reference, the mutated base pairs at each position were analyzed. The weighted number of group 1 and group 2 mutated base pairs was calculated and compared between different samples (see text for details). Data are expressed as the mean ± standard deviations for IR, LM, and Sys samples, and as a single value for the inoculum pools. Student’s t-test was applied for data comparisons: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, ns , not statistically significant.

    Article Snippet: The PCR product libraries were sequenced on the Illumina NovaSeq 6000 platform (Lianchuan Biotechnology Co. Ltd., China).

    Techniques: Sequencing, Mutagenesis, Isolation